translate my sequence?

Question

I have to write a script to translate this sequence:

dict = {"TTT":"F|Phe","TTC":"F|Phe","TTA":"L|Leu","TTG":"L|Leu","TCT":"S|Ser","TCC":"S|Ser",
              "TCA":"S|Ser","TCG":"S|Ser", "TAT":"Y|Tyr","TAC":"Y|Tyr","TAA":"*|Stp","TAG":"*|Stp",
              "TGT":"C|Cys","TGC":"C|Cys","TGA":"*|Stp","TGG":"W|Trp", "CTT":"L|Leu","CTC":"L|Leu",
              "CTA":"L|Leu","CTG":"L|Leu","CCT":"P|Pro","CCC":"P|Pro","CCA":"P|Pro","CCG":"P|Pro",
              "CAT":"H|His","CAC":"H|His","CAA":"Q|Gln","CAG":"Q|Gln","CGT":"R|Arg","CGC":"R|Arg",
              "CGA":"R|Arg","CGG":"R|Arg", "ATT":"I|Ile","ATC":"I|Ile","ATA":"I|Ile","ATG":"M|Met",
              "ACT":"T|Thr","ACC":"T|Thr","ACA":"T|Thr","ACG":"T|Thr", "AAT":"N|Asn","AAC":"N|Asn",
              "AAA":"K|Lys","AAG":"K|Lys","AGT":"S|Ser","AGC":"S|Ser","AGA":"R|Arg","AGG":"R|Arg",
              "GTT":"V|Val","GTC":"V|Val","GTA":"V|Val","GTG":"V|Val","GCT":"A|Ala","GCC":"A|Ala",
              "GCA":"A|Ala","GCG":"A|Ala", "GAT":"D|Asp","GAC":"D|Asp","GAA":"E|Glu",
              "GAG":"E|Glu","GGT":"G|Gly","GGC":"G|Gly","GGA":"G|Gly","GGG":"G|Gly"}

seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"
a=""

for y in range( 0, len ( seq)):
    c=(seq[y:y+3])
    #print(c)
    for  k, v in dict.items():
        if seq[y:y+3] == k:
            alle_amino = v[::3] #alle aminozuren op rijtje, a1.1 -a2.1- a.3.1-a1.2 enzo
            print (v)

With this script I get the amino acids from the 3 frames under each other, but how can I sort this and get all the amino acids from frame 1 next to each other, and all the amino acids from frame 2 next to each other, and the same for frame 3?

for example , my results must be :

+3 SerIleLeuAlaStpProLysTrpGluProProTyrValAlaStpProIleTyrIleTyrTle

+2 PheAsnThrSerMetThrLysValGlyThrProLeuArgSerMetThrHisIleTyrIleTyr

+1 PheGlnTyrStpHisAspGlnSerGlyAsnProLeuThrStpHisAspProTyrIleTyrIle

TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA

I use Python 3.

i had one more question : can i make this results by some changes in mine own script ?

i have delete the first question, i hope my question is now more clear — Emine Poyraz, Jan 02 '12 at 12:47
A bit clearer. BTW, you shouldn't use `dict` as a variable name, as that will shadow the builtin `dict`! — Ricardo Cárdenes, Jan 02 '12 at 12:54
what do you mean by frame? and what exactly does +1, +2... refer to? — Hoff, Jan 02 '12 at 12:55
The exact same question, with only slightly different sequences, has been posted numerous time last year. Do some searching. — Some programmer dude, Jan 02 '12 at 12:56
Your example is way to confusing. Shorten it to the essential parts. — Don Question, Jan 02 '12 at 12:57
frame is one of the translated lines, first line (+1 line) is the translation of my whole sequence sequend line ( 2+ line) is the translation of my whole seq beginning with the fist position of my sequence and the third line (+3 line) is the translation beginning with my sequend postion positions beginning bij zero — Emine Poyraz, Jan 02 '12 at 12:59
You should edit the question instead of providing additional details in comments — gecco, Jan 02 '12 at 13:56

joaquin · Accepted Answer · 2012-01-02T14:44:39.580

You can use (Note this would be ridiculously much more easier using biopython translate method):

dictio = {your dictionary here}

def translate(seq):
    x = 0
    aaseq = []
    while True:
        try:
            aaseq.append(dicti[seq[x:x+3]])
            x += 3
        except (IndexError, KeyError):
            break
    return aaseq

seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"

for frame in range(3):
    print('+%i' %(frame+1), ''.join(item.split('|')[1] for item in translate(seq[frame:])))

Note I changed the name of your dictionary with dicti (not to overwrite dict).

Some comments to help you understand:

translate takes you sequence and returns it in the form of a list in which each item corresponds to the amino acid translation of the triplet coding that position. Like:

aaseq = ["L|Leu","L|Leu","P|Pro", ....]

you could process more this data (get only one or three letters code) inside translate or return it as it is to be processed latter as I have done.

translate is called in

''.join(item.split('|')[1] for item in translate(seq[frame:]))

for each frame. For frame value being 0, 1 or 2 it sends seq[frame:] as a parameter to translate. That is, you are sending the sequences corresponding to the three different reading frames processing them in series. Then, in

   ''.join(item.split('|')[1]

I split the one and three-letters codes for each amino acid and take the one at index 1 (the second). Then they are joined in a single string

thanks so much for your help , but can you help me by writting this script more extensive, because i'm a starter and don't understand all the script you have written for me — Emine Poyraz, Jan 02 '12 at 14:11
Not sure what you want. If you put this code (and as far as I tested the same can be said of the one from @RicardoCárdenes) in a file it works with no change (obviously you should include the full dict of translations). I edited my code to make it unambigous. If this is homework you should tag it accordingly — joaquin, Jan 02 '12 at 14:21

score 1 · Answer 2 · answered Jan 02 '12 at 13:06

Not too pretty, but does what you want

dct = {"TTT":"F|Phe","TTC":"F|Phe","TTA":"L|Leu","TTG":"L|Leu","TCT":"S|Ser","TCC":"S|Ser", 
"TCA":"S|Ser","TCG":"S|Ser", "TAT":"Y|Tyr","TAC":"Y|Tyr","TAA":"*|Stp","TAG":"*|Stp", 
"TGT":"C|Cys","TGC":"C|Cys","TGA":"*|Stp","TGG":"W|Trp", "CTT":"L|Leu","CTC":"L|Leu", 
"CTA":"L|Leu","CTG":"L|Leu","CCT":"P|Pro","CCC":"P|Pro","CCA":"P|Pro","CCG":"P|Pro", 
"CAT":"H|His","CAC":"H|His","CAA":"Q|Gln","CAG":"Q|Gln","CGT":"R|Arg","CGC":"R|Arg", 
"CGA":"R|Arg","CGG":"R|Arg", "ATT":"I|Ile","ATC":"I|Ile","ATA":"I|Ile","ATG":"M|Met", 
"ACT":"T|Thr","ACC":"T|Thr","ACA":"T|Thr","ACG":"T|Thr", "AAT":"N|Asn","AAC":"N|Asn", 
"AAA":"K|Lys","AAG":"K|Lys","AGT":"S|Ser","AGC":"S|Ser","AGA":"R|Arg","AGG":"R|Arg", 
"GTT":"V|Val","GTC":"V|Val","GTA":"V|Val","GTG":"V|Val","GCT":"A|Ala","GCC":"A|Ala", 
"GCA":"A|Ala","GCG":"A|Ala", "GAT":"D|Asp","GAC":"D|Asp","GAA":"E|Glu", 
"GAG":"E|Glu","GGT":"G|Gly","GGC":"G|Gly","GGA":"G|Gly","GGG":"G|Gly"}


seq = "TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA"

def get_amino_list(s):
    for y in range(3):
        yield [s[x:x+3] for x in range(y, len(s) - 2, 3)]

for n, amn in enumerate(get_amino_list(seq), 1):
    print ("+%d " % n + "".join(dct[x][2:] for x in amn))

print(seq)

Carl F. · Answer 3 · 2012-01-02T13:47:17.297

Here's my solution. I've called your "dict" variable "aminos". The function method3 returns a list of the values to the right of the "|". To merge them into a single string, just join them on "".

From looking at your code, I believe that your aminos dict contains all possible three-letter combinations. Therefore, I've removed the checks that verify this. It should run a lot faster as a result.

def overlapping_groups(seq, group_len=3):
    """Returns `N` adjacent items from an iterable in a sliding window style
    """
    for i in range(len(seq)-group_len):
        yield seq[i:i+group_len]

def method3(seq, aminos):
    return [aminos[k][2:] for k in overlapping_groups(seq, 3)]

for i in range(3):
    print("%d: %s" % (i, "".join(method3(seq[i:], aminos))))

translate my sequence?

3 Answers3

Linked