1

Is there a method in Perl (not BioPerl) to find the number of each two consecutive letters.

I.e., number of AA, AC, AG, AT, CC, CA, ... in a sequence like this:

$sequence = 'AACGTACTGACGTACTGGTTGGTACGA'

PS: We can make it manually by using the regular expression, i.e., $GC=($sequence=~s/GC/GC/g) which return the number of GC in the sequence.

I need an automated and generic way.

Peter Mortensen
  • 30,738
  • 21
  • 105
  • 131
AWRAM
  • 333
  • 2
  • 16
  • Do the matches need to overlap - for example, do the 2nd and 3rd characters above count as an "AC"? – Bill Ruppert Nov 18 '11 at 15:04
  • no only the 2 consecutive letters – AWRAM Nov 18 '11 at 15:41
  • @AWRAM A and C **are** consecutive in the 2nd and 3rd position. Do you mean to say that `AACG` should only count as AA and CG? – TLP Nov 18 '11 at 15:48
  • Since I'm not familiar with bio: dinucleotides are represented by each two characters in this string or there's list of existing dinucleotides and string contains sequences of 1 or 3+ long atomic group of characters? – yko Nov 18 '11 at 16:05
  • yes yes it doesn't matter from the first we have AA and AC CG and GT.. – AWRAM Nov 18 '11 at 17:33

3 Answers3

3

You had me confused for a while, but I take it you want to count the dinucleotides in a given string.

Code:

my @dinucs = qw(AA AC AG CC CA CG);
my %count;
my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';

for my $dinuc (@dinucs) {
    $count{$dinuc} = ($sequence =~ s/\Q$dinuc\E/$dinuc/g);
}

Output from Data::Dumper:

$VAR1 = {
          "AC" => 5,
          "CC" => "",
          "AG" => "",
          "AA" => 1,
          "CG" => 3,
          "CA" => ""
        };
Peter Mortensen
  • 30,738
  • 21
  • 105
  • 131
TLP
  • 66,756
  • 10
  • 92
  • 149
  • The question doesn't make it clear, but I think overlapping is an issue here in this application. The string should be processed two at a time. – Zaid Nov 18 '11 at 15:30
  • @Zaid It's based on his own solution, which he claims works for him. – TLP Nov 18 '11 at 15:34
  • Which probably means his own solution doesn't give him the right answer :) – pavel Nov 18 '11 at 15:44
  • @pavel That was the only part of his question that I thought was clear: He *could* do it *manually*, but he wants an automated and generic solution. – TLP Nov 18 '11 at 15:45
  • You could have also used `$count{$dinuc} = $sequence =~ tr/$dinuc/$dinuc/;` – Zaid Nov 18 '11 at 16:47
  • This code fails to count AA/CC/GG/TT dinucs correctly. plug in `$sequence = CCCC` and the above will return a count `CC => 2` (should be 3). This is a significant error as there are long repeated regions in many genomes. you need look-ahead for these cases. – flies Dec 15 '11 at 21:34
3

Close to TLP's answer, but without substitution:

my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';
my @dinucs = qw(AA AC AG AT CC CG);
my %count = map{$_ => 0}@dinucs;

for my $dinuc (@dinucs) {
    while($sequence=~/$dinuc/g) {
        $count{$dinuc}++;
    }
}

Benchmark:

my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';
my @dinucs = qw(AA AC AG AT CC CG);
my %count = map{$_ => 0}@dinucs;

my $count = -3;
my $r = cmpthese($count, {
        'match' => sub {
            for my $dinuc (@dinucs) {
               while($sequence=~/$dinuc/g) {
                    $count{$dinuc}++;
               }
            }
        },
        'substitute' => sub {
            for my $dinuc (@dinucs) {
                $count{$dinuc} = ($sequence =~ s/\Q$dinuc\E/$dinuc/g);
            }
         }
});

Output:

              Rate substitute      Match
Substitute 13897/s         --       -11%
Match      15622/s        12%         --
Peter Mortensen
  • 30,738
  • 21
  • 105
  • 131
Toto
  • 89,455
  • 62
  • 89
  • 125
1

Regex works if you're careful, but there's a simple solution using substr that will be faster and more flexible.

(As of this posting, the regex solution marked as accepted will fail to correctly count dinucleotides in repeated regions like 'AAAA...', of which there are many in naturally occurring sequences.

Once you match 'AA', the regex search resumes on the third character, skipping the middle 'AA' dinucleotide. This doesn't affect the other dinucleotides since if you have 'AC' at one position, you're guaranteed not to have it in the next base, naturally. The particular sequence given in the question will not suffer from this problem since no base appears three times in a row.)

The method I suggest is more flexible in that it can count words of any length; extending the regex method to longer words is complicated since you have to do even more gymnastics with your regex to get an accurate count.

sub substrWise {
    my ($seq, $wordLength) = @_;

    my $cnt = {};

    my $w;
    for my $i (0 .. length($seq) - $wordLength) {
        $w = substr($seq, $i, $wordLength);
        $cnt->{$w}++;
    }

    return $cnt;
}

sub regexWise {
    my ($seq, $dinucs) = @_;

    my $cnt = {};
    for my $d (@$dinucs) {
        if (substr($d, 0,1) eq substr($d, 1,1) ) {
            my $n = substr($d, 0,1);
            $cnt->{$d} = ($seq =~ s/$n(?=$n)/$n/g); # use look-ahead
        } else {
            $cnt->{$d} = ($seq =~ s/$d/$d/g);
        }
    }

    return $cnt;
}


my @dinucs = qw(AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT);

my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';

use Test::More tests => 1;
my $rWise = regexWise($sequence, \@dinucs);
my $sWise = substrWise($sequence, 2);
$sWise->{$_} //= '' for @dinucs; # substrWise will not create keys for words not found
# this seems like desirable behavior IMO,
# but i'm adding '' to show that the counts match
is_deeply($rWise, $sWise, 'verify equivalence');

use Benchmark qw(:all);
cmpthese(100000, {
    'regex' => sub {
        regexWise($sequence, \@dinucs);
    },
    'substr' => sub {
        substrWise($sequence, 2);
    }

Output:

1..1
ok 1 - verify equivalence
          Rate  regex substr
regex  11834/s     --   -85%
substr 76923/s   550%     --

For longer sequences (10-100 kbase), the advantage is not as pronounced, but it still wins by about 70%.

Peter Mortensen
  • 30,738
  • 21
  • 105
  • 131
flies
  • 2,017
  • 2
  • 24
  • 37