Here is my basic issue:
I have the following: file name: parseFastq.py execution: via command line code to run it: python3 parseFastq.py --fastq /Users/remaining_dir/test1.fastq
This code works!!!
However, when I copy the components of parseFastq.py issues arise.
Below is the code:
Class is first defined...this part works and runs fine on my new script.
import argparse
import gzip
#Example use is
# python parseFastq.py --fastq /Users/remaining_dir/test1.fastq
################################################
# You can use this code and put it in your own script
class ParseFastQ(object):
"""Returns a read-by-read fastQ parser analogous to file.readline()"""
def __init__(self,filePath,headerSymbols=['@','+']):
"""Returns a read-by-read fastQ parser analogous to file.readline().
Exmpl: parser.__next__()
-OR-
Its an iterator so you can do:
for rec in parser:
... do something with rec ...
rec is tuple: (seqHeader,seqStr,qualHeader,qualStr)
"""
if filePath.endswith('.gz'):
self._file = gzip.open(filePath)
else:
self._file = open(filePath, 'rU')
self._currentLineNumber = 0
self._hdSyms = headerSymbols
def __iter__(self):
return self
def __next__(self):
"""Reads in next element, parses, and does minimal verification.
Returns: tuple: (seqHeader,seqStr,qualHeader,qualStr)"""
# ++++ Get Next Four Lines ++++
elemList = []
for i in range(4):
line = self._file.readline()
self._currentLineNumber += 1 ## increment file position
if line:
elemList.append(line.strip('\n'))
else:
elemList.append(None)
# ++++ Check Lines For Expected Form ++++
trues = [bool(x) for x in elemList].count(True)
nones = elemList.count(None)
# -- Check for acceptable end of file --
if nones == 4:
raise StopIteration
# -- Make sure we got 4 full lines of data --
assert trues == 4,\
"** ERROR: It looks like I encountered a premature EOF or empty line.\n\
Please check FastQ file near line number %s (plus or minus ~4 lines) and try again**" % (self._currentLineNumber)
# -- Make sure we are in the correct "register" --
assert elemList[0].startswith(self._hdSyms[0]),\
"** ERROR: The 1st line in fastq element does not start with '%s'.\n\
Please check FastQ file near line number %s (plus or minus ~4 lines) and try again**" % (self._hdSyms[0],self._currentLineNumber)
assert elemList[2].startswith(self._hdSyms[1]),\
"** ERROR: The 3rd line in fastq element does not start with '%s'.\n\
Please check FastQ file near line number %s (plus or minus ~4 lines) and try again**" % (self._hdSyms[1],self._currentLineNumber)
# -- Make sure the seq line and qual line have equal lengths --
assert len(elemList[1]) == len(elemList[3]), "** ERROR: The length of Sequence data and Quality data of the last record aren't equal.\n\
Please check FastQ file near line number %s (plus or minus ~4 lines) and try again**" % (self._currentLineNumber)
# ++++ Return fatsQ data as tuple ++++
return tuple(elemList)
##########################################################################
This is the code that will not work when calling it in the same script; it has to do with putting the pieces in :
if __name__ == "__main__":
parser = argparse.ArgumentParser(description='Process fasq files and seperaate into 4 categories')
parser.add_argument("-f", "--fastq", required=True, help="Place fastq inside here")
args = parser.parse_args()
fastqfile = ParseFastQ(args.fastq)
I tried the following and I cannot get fastqfile which should contain a tuple with the following: (seqHeader,seqStr,qualHeader,qualStr)
Attemp:
parser.add_argument("-/Users/remaining_dir/test1.fastq", "--fastq", required=True, help="Place fastq inside here")
Error:
argument -/Users/remaining_dir/test1.fastq/--fastq: conflicting option string: --fastq
Attemp:
parser.add_argument("-/Users/remaining_dir/test1.fastq", "-@", required=True, help="Place fastq inside here")
Out[332]:
_StoreAction(option_strings=['-/Users/remaining_dir/test1.fastq', '-@'], dest='/Users/remaining_dir/test1.fastq', nargs=None, const=None, default=None, type=None, choices=None, help='Place fastq inside here', metavar=None)
next line:
Error:
usage: [-h] -/Users/remaining_dir/test1.fastq
/USERS/REMAINING_DIR/TEST1.FASTQ
: error: the following arguments are required: -/Users/remaining_dir/test1.fastq/-@
An exception has occurred, use %tb to see the full traceback.
SystemExit: 2
when %tb selected the following info was give:
File "/Users/brownbear/opt/anaconda3/lib/python3.7/argparse.py", line 2508, in error
self.exit(2, _('%(prog)s: error: %(message)s\n') % args)
File "/Users/brownbear/opt/anaconda3/lib/python3.7/argparse.py", line 2495, in exit
_sys.exit(status)
if helpful, I am including some sample fastq data
@seq13534-419
GCAGTAGCGGTCATAAGTGGTACATTACGAGATTCGGAGTACCATAGATTCGCATGAATCCCTGTGGATACGAGAGTGTGAGATATATGTACGCCAATCCAGTGTGATACCCATGAGATTTAGGACCGATGATGGTTGAGGACCAAGGATTGACCCGATGGATGCAGATTTGACCCCAGATAGAATAAATGCGATGAGATGATTTGGCCGATAGATAGATAGTGTCGTGAGGTGACGTCCGTCACTGGACGAA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFFFFDFFDFFDDFDFDFFFFDDFFDDFDDFF
@seq86249-867
GGATTAGCGGTCATAAGTCGTACATTACGAGATTCGGAGTACCATAGATTCGCATGAATCCCTGTGGATACGAGAGTGTGAGATATATGTACGCCAATCCAGTGTGATACCCATGAGATTTAGGACCGATGATGGTTGAGGACCAAGGATTGACCCGATGGATGCAGATTTGACCCCAGATAGAATAAATGCGATGAGATGATTTGGCCGATAGATAGATAGAGGTCAGTATAACCTCTCAAAGCTTTATCTACGGATGGATCCGCGC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIDDFDDDDDDFFDFDDFDDDFDFFDDFFFFFFFFFDDFDFFDDFDDF
@seq46647-928
GACCTAGCGGTCATAAGTGGTACATTACGAGATTCGGAGTACCATAGATTCGCATGAATCCCTGTGGATACGAGAGTGTGAGATATATGTACGCCAATCCAGTGTGATACCCATGAGATTTAGGACCGATGATGGTTGACGACCAAGGATTGACCCGATGGATGCAGATTTGACCCCAGATAGAATAAATGCGATGAGATGATTTGGCCGATAGATAGATAGTAAGTAAATGCCACGGACTCGTCACGTG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIDDDFDFDFFFFFDFFDFDFDDDDDFDFF
Any help would be appreciated on why this works when I run the script but now when I try and incorporate within a script