1

I've already looked here and in other forums, but couldn't find the answer to my question.

I want to design baits for a target enrichment Sequencing approach and have the output of a MarkerMiner search for orthologous loci from four different genomes with A.
thaliana as a Reference as. These output alignments are separate Fasta-Files for each A. thaliana annotated gene with the sequences from my datasets aligned to it.
I have already run a script to filter out those loci supported to be orthologous by at least two of my four input datasets.

However, now, I'm stumped.
My alignments are gappy, since the input data is mostly RNAseq whereas the Reference contains the introns as well. So it looks like this :

AT01G1234567 ATCGATCGATGCGCGCTAGCTGAATCGATCGGATCGCGGTAGCTGGAGCTAGSTCGGATCGC MyData1
CGATGCGCGC-----------CGGATCGCGG---------------CGGATCGC
MyData2
CGCTGCGCGC------------GGATAGCGG---------------CGGATCCC

To effectively design baits I now need to extract all the aligned parts from the file, so that I will end up with separate files; or separate alignments within the file; for the parts that are aligned between MyData and the Reference sequence with all the gappy parts excluded. There are about 1300 of these fasta files, so doing it manually is no option. I have a bit of programming experience in python and with Linux command line tools, however I am completely lost on how to go about this. I would appreciate a hint, on what kind of tools are out there I could use or what kind of algorithm I need to come up with. Thank you. Cheers

Chris_Rands
  • 38,994
  • 14
  • 83
  • 119
sci_cloudy
  • 11
  • 4
  • 1
    Could you provide an example of the output you would like to achieve? – emilliman5 Nov 17 '16 at 21:07
  • 1
    How many sequences are they in each alignment ? If not too many, you can probably read all sequences in memory, then run along your alignment using an alignment column index and generate your aligned portions. Some tools from biopython or p4 might be useful. For instance http://p4.nhm.ac.uk/modules/alignment.html#p4.alignment.Alignment.gappedMask to be used in conjunction with http://p4.nhm.ac.uk/modules/alignment.html#p4.alignment.Alignment.subsetUsingMask You would need to get p4 to read your alignments. – bli Nov 21 '16 at 14:53
  • Note that there is now a beta bioinformatics stackexchange site where this question might receive answers: https://bioinformatics.stackexchange.com/ – bli May 24 '17 at 12:42

0 Answers0