I used UCSC blat to search for a horse genomic sequence. Three results were returned, two were unplaced scaffolds, and the other was chr1. All had 100% identity to my query (gagttcctagacaccaaatacaacgtgggaatacacaacctactggcctatgtgaaacacctgaaaggccagaatgaggaagccctgaagagcttgagagaagctgaagacttaatccaggaagaacatggtgaccaatcaggcat). My question is, are there 3 copies of this gene in the horse, or can the scaffolds belong to chr1? For what its worth, there is only one copy of the gene in mouse.
Asked
Active
Viewed 261 times
-1
-
I'm voting to close this question as off-topic because it's about dna encoding and has nothing whatsoever to do with IT – Software Engineer Nov 17 '15 at 21:33
1 Answers
0
The answer turns out to be all 3 results are unique places in the genome. Unplaced scaffolds are sequences in the genome that are being worked on, but have not been added to the reference genome.
Patrickc01
- 145
- 1
- 1
- 6