Concatenation in C with 2D char array

Question

I am reading in a textfile line by line into a 2D array. I want to concatenate the char arrays so I have one long char array. I am having trouble with this, I can get it to work with two char arrays but when I try to do a lot of them I go wrong.

Currently the char arrays look like this:

AGCTTTTCATTC

I want to get something like this:

AGCTTTTCATTCAGCTTTTCATTC

I have inlcuded some of my code.

int counter = 0; 
fid = fopen("dna.fna","r");
while(fgets(line, sizeof(line), fid) != NULL && counter!=66283 ) {
    if (strlen(line)==70) {
        strcpy(dna[counter], line);        
    counter++;
    }
}
int dnaSize = 6628; 
//Concatenating the DNA into a single char array.
int i;
char DNA[dnaSize];
for(i = 0; i<66283;i++){
   strcpy(DNA[i],dna[i]);
   strcat(DNA[i+1],dna[i+1]);
}

-1 Sorry but I had to balance the score of this question up. It lacks research effort in my opinion. I think if you read up on `strcpy` and `strcat` you could have got further on your own. P.S. would be nice to see definition of `dna` because that could be using the first `strcpy` wrong too. — weston, Dec 09 '12 at 16:11

weston · Accepted Answer · 2012-12-09T16:29:51.313

You need to loop only up to < counter Then, are you copying or concatenating? You only need to do one or the other.

I suggest just use strcat in the loop, but initialise DNA.

char DNA[dnaSize] = ""; //initalise so safe to pass to strcat
for(i = 0; i<counter;i++)
{
   strcat(DNA,dna[i]); //no need for indexer to DNA
}

Also, you need to consider the sizes of your two arrays. I believe (hope) that dna is an array of an array of char. If it is, I guess it is 66283 long in it's first dimension alone. So it is not going to fit into DNA (6628 long), even if each line was 1 char in length.

Here is an idea on how to allocate exactly the right amount of memory:

#define MAXLINELENGTH (70)
#define MAXDNALINES (66283)

//don't copy this line, it will not work because of the sizes involved (over 4MB)
//it will likely stack overflow
//just do what you are currently doing as long as it's a 2-d array.
char dna[MAXDNALINES][MAXLINELENGTH + 1];

int counter = 0; 
int totalSize = 0;
fid = fopen("dna.fna","r");
while(fgets(line, sizeof(line), fid) != NULL && counter!=MAXDNALINES ) {
    const int lineLength = strlen(line);
    if (lineLength==MAXLINELENGTH) {
        strcpy(dna[counter], line);        
        counter++;
        totalSize += lineLength;
    }
}

//Concatenating the DNA into a single char array (of exactly the right length)
int i;
char *DNA = malloc(totalSize+1); // the + 1 is for the final null, and putting on heap so don't SO
DNA[0] = '\0'; //the initial null is so that the first strcat works
for(i = 0; i<counter;i++){
   strcat(DNA,dna[i]);
}

//do work with DNA here

//finally free it  
free(DNA);

Concatenation in C with 2D char array

1 Answers1