Stack Overflow
Stack Overflow

Questions tagged [paste]

The paste tag is to be used for issues relating to the paste portion of copy/paste operations.

Cut and paste and copy and paste offer user-interface paradigms for transferring text, data, files or objects from a source to a destination. The paste operation performs the copy to destination, whereas the source is often a clipboard. Often, hotkeys are employed to provide the paste functionality.

2546 questions
0
votes
0 answers

Getting clipboard data in HTML format when pasting in Tabulator 4.9

We are developing an application that relies heavily on the Tabulator library. We want to support 2 different locales for the numbers' format, the Dutch one and the UK one. Main action that the clients do is pasting data from Excel file directly…
Alek
  • 56
  • 3
0
votes
3 answers

Combining lines that occur between lines that contain a certain character

I am trying to manipulate a FASTA file with the general format: >ReadID other text ACTGACTGACTGACTGACTGACTGACTGACTGACTG >ReadID other text ACTGACTGACTGACTGACTGACTGACTGACTGACTG >ReadID other text ACTGACTGACTGACTGACTGACTGACTGACTGACTG I was attempting…
Billy Mills
  • 79
  • 7
0
votes
0 answers

How to get 's value after pasting?

I need to get the value of an html input after some text has been pasted. Seems obvious to handle the input's onpaste event, but that appears to fire before the text is actually pasted. For example... When one pastes some text into that input the…
curtisdehaven
  • 15
  • 4
0
votes
4 answers

Continuously paste to a file in a loop without overwriting

I would like to paste an output file from a loop side to side with each file generated from the loop without overwriting the file. If it was just append it would be fine with >> but struggling to find a way where I can keep adding to a file so…
dcp1234
  • 65
  • 6
0
votes
0 answers

merge 2 files based on 1,2,3 column matching in 2 files & print specific columns from 2 files. also retain non-pairing rows from both files in output

file1 CHR POS ID REF ALT D1 D2 D3 3 35863940 rs15689009 T C,G NO NO YES 11 85123789 rs78018396 G A,T NO YES YES 9 11234300 rs6512203 G A,C,T YES YES NO 22 1728499 rs00981837 A G,T NO NO YES file2 CHR POS…
rij
  • 159
  • 7
0
votes
2 answers

R cbind with get paste

cbind() function works as x <- cbind(a,b) where column name 'b' can be specified for the function b = get(paste0('var',i)), that is x <- cbind(a,b = get(paste0('var',i))) I am trying to do the following: x <- cbind(a, get(paste0('var',i))) = j),…
Gregory
  • 109
  • 1
  • 7
0
votes
1 answer

How to jump from one field to the next on a web page from a VB String

My VB program is more or less a data entry application. I have ten fields on a third party web page that I want to fill using a String placed on the clipboard. I get a TitleNumber (TNtext) from the ClipBoard. I get a preFix, usrName and imageCount…
JerrMerr
  • 11
  • 4
0
votes
1 answer

VBA Paste array of cells between Workbooks at last Populated row (Paste not working?)

I am trying to copy an array of data from a csv file to the next available row in a separate workbook in my "PowerBI_table" sheet (starting in column V). When I F8 through the code, no error codes appear, and the information is copied from the csv…
Matt
  • 55
  • 6
0
votes
1 answer

Stop VBA from changing text to date when copy/paste

I want to copy some texts from a sheet to another. For example: 01/02/2021 . However VBA automatically convert it to 2020/01/02. How can I stop it? The following codes didn't work. Example1: sheet_1.Range("A1:A" & sheet1.Cells(1,…
max
  • 47
  • 5
0
votes
1 answer

How to paste VALUES ONLY in excel VBA?

So I need to paste the values only of a range of data into the sheet "MasterList". I was looking for ways to do this and found this: .PasteSpecial Paste:=xlPasteValues How should I go about changing my code so that I can use the .PasteSpecial…
Jhenna
  • 1
  • 2
0
votes
1 answer

Pipe a certain field of an input stream in a command, and paste back the results

Say I have an input stream consisting of lines separated into a certain number of fields. I would like to cut on the various fields, pipe a certain field (or fields) to a program (which is assumed to return one line for each input line) and leave…
a3nm
  • 8,717
  • 6
  • 31
  • 39
0
votes
1 answer

Excel VBA Cut & paste active row on an active sheet,active row to first blank row on another worksheet

I can copy and paste from an active sheet and active row to an "Activesheet_Archivesheet" on the next blank line but if I try and cut and paste I cannot find the code to find the next blank line and "paste". Any pointers please? (ie if I have missed…
stevie.tom
  • 1
  • 1
0
votes
0 answers

VBA - Copy / Paste to multiple columns with variable row start (array)

I'd like to shorten my code by putting multiple columns to one command. I'm copying formulas from one row but specified columns and want to paste to another sheet in the same wksht. Just the row number is a variable. Maybe do this by an array? As an…
Maskot
  • 3
  • 5
0
votes
0 answers

VBA code to Copy Excel range $A$1, Paste into Saved WordDocument (Not New Document), SaveAs that document Filename As another Excel range $A$2

Working with both Word and Excel macros, I am trying to copy from excel then paste it into MSWord then give that Word file a new name as another excel cell value. I want to create an Excel VBA Code to: copy cell A1 from excel, open a saved word…
pjv
  • 1
  • 2
0
votes
3 answers

pasting many files to a single large file

i have many text files in a directory like 1.txt 2.txt 3.txt 4.txt .......2000.txt and i want to paste them to make a large file. In this regard i did something like paste *.txt > largefile.txt but the above command reads the .txt file randomly, so…
manas
  • 479
  • 2
  • 14
1 2 3
…
99 100