Stack Overflow
Stack Overflow

Questions tagged [genome]

Genome is the entirety of an organism's DNA sequence. The genome includes both the genes and the non-coding sequences, such as repeats, introns and regulatory sequences, possessing both known and unknown function.

230 questions
-1
votes
1 answer

Encoding a value in gray code with floating point with negatives

My objective here is to be able to convert any number between -4.0 and 4.0 into a 5 bit binary string using gray code. I also need to be able to convert back to decimal. Thanks for any help you can provide. If it helps, the bigger picture here is…
zaedric
  • 45
  • 1
  • 7
-1
votes
1 answer

percentage of missing data in R gives error

My data looks like this in R console: dim(df1) [1] 54003 994 df1[1:10, 1:10] marker X1 X73 X88 X9 X17 X25 X33 X41 X49 1 1228104|F|0-8:C>T-8:C>T 0 0 0 0 0 NA 0 0 0 2 2277607|F|0-10:A>T-10:A>T NA …
Marilou
  • 31
  • 8
-1
votes
1 answer

Convert .gprobs files from Impute2 to PLINK format

I have some imputed .gprobs files (one per chromosome), imputed by Impute2 downloaded from dbGaP, and I need to convert this file into .bed format of PLINK in order to do some analysis. My .gprobs files look like: --- rs371609562:61395:CTT:C 61395…
Laure Tomás Daza
  • 117
  • 1
  • 6
-1
votes
2 answers

Is there any open source tools available for chimeric sequence detection?

Is there any tools for detecting and removing chimeric sequences from 16s,WGS,WTS sequences other than USearch. The alternative should be open source so that it can be used for commercial purposes.
Vaisakh Viswanath
  • 33
  • 7
-1
votes
1 answer

Error in champ.lasso of ChAMP Bioconductor package for Methylation 450k analysis

I have just installed ChAMP and all of its dependencies for methylation 450k analysis. I was trying out the tutorial (http://www.bioconductor.org/packages/release/bioc/vignettes/ChAMP/inst/doc/ChAMP.pdf) but got an error. When running the Probe…
Nicholas Syn
  • 29
  • 5
-1
votes
1 answer

LiftOver in R (error)

I am trying to use the LiftOver function in rtracklayer package but I am getting one error, this is my code: library(rtracklayer) library(gwascat) library(IRanges) chain <- import.chain("bosTau6.hg19.all.chain") df <-…
user3091668
  • 2,230
  • 6
  • 25
  • 42
-1
votes
1 answer

How to use blat tool for searching a gene in the genome?

I need to work with blat tool. I need to find the start and end positions of some genes in the genome. I downloaded the tool from the link below: http://genome.ucsc.edu/FAQ/FAQblat.html , a blat file + blatSrc.zip file. I dont know how to run it.…
farnush.farhadi
  • 57
  • 2
  • 4
-2
votes
1 answer

AWK to handle bed files

I would like to grep and separate fields from bed files to generate a new bed file with these new arranged data. I would go from here: 1 15903 rs557514207 G G,A…
DaN
  • 3
  • 5
-2
votes
1 answer

awk to separate rows from bed files depending on character

I want to separate rows by comma delimiter in one filed and keep the other information of the row. I have tab delimited files with 4 columns and a lot of rows... Frome here: 1 13445 rs558318514 C G,T 1_13445 1 13453 rs568927457 T C 1_13455 1…
DaN
  • 3
  • 5
-2
votes
1 answer

how to extract only mapped reads?

I have mapped a pacbio read against a reference [with minimap2] and now I have my output in Bam file. I would like to extract only the mapped reads from it. I tried bamToFastq [samtools bamtofq input.bam | seqtk seq -A > output.fa], since finally…
azam soltani
  • 1
  • 1
-2
votes
1 answer

KEGG Annotation

I have a set of genes (Amino acid sequences). I want to find the Kegg based functional annotations or KO ids. Is there any KEGG database available for download? I want to use blast with that database. Additionally, I was looking for R package that…
Furqan
  • 59
  • 1
  • 8
-2
votes
2 answers

Looping over list multiple times

Is it possible to iterate through a list multiple times? basically, I have a list of strings and I am looking for the longest superstring. Each of the strings in the list has some overlap of at least half of their length and they are all the same…
Ryan Meagher
  • 17
  • 4
-2
votes
3 answers

Building a new String by cutting an old string? (Java Code if you could)

Hi guys I am trying to read a genomic sequence and search for any 10 character repeats that appear. The solution that I have in mind is broken down into three steps: Read the Genomic sequence ex: GAAAAATTTTCCCCCACCCTTTTCCCC Cut the String into…
Justin Reid
  • 119
  • 1
  • 9
-2
votes
1 answer

How to get fragments from a DNA sequence

I want to cut a DNA genome into any k-mer size, so I created the function Sliding_DNA(dna_list,size_to_split) but I doesn't work. Can somebody help me! When I print out the variable pedazos, it gives me the…
user3275981
  • 21
  • 4
-2
votes
1 answer

Writing a GUI to manipulate the variables in a Python program and then run the Program

So I have a gui that I'm working on (http://pastebin.com/0fPLHyHw) that I want to manipulate a program in Python that I don't quite understand (http://pastebin.com/uruxJXLx). But basically what I want to have the GUI choose the input file (e.g. a…
Dan Mallory
  • 1
  • 2
1 2 3
…
15
16