Stack Overflow
Stack Overflow

Questions tagged [fuzzy]

DO NOT USE - ambiguous: see fuzzy-search, fuzzy-logic, or image-processing for more appropriate tags.

Do not use this tag. It is ambiguous: see , , or for more appropriate tags.

363 questions
1
vote
0 answers

Calculating Sugeno outputs

I cant figure out how MATLAB calculates the output value based on the inputs. I managed to work out how mamdami functions work (through area and centroids) however I cant fathom how to calculate the output. The below link does give the formula but I…
Chris
  • 1,766
  • 1
  • 21
  • 36
1
vote
1 answer

Extracting date from a string in PHP

How can I extract the date from an arbitrary string such as "Joe Soap was born on 12 February 1981"? Python has a wonderful fuzzy parsing functionality provided by python-dateutil as described in this question. I'm looking for a library that…
Richard Keller
  • 1,980
  • 2
  • 19
  • 32
1
vote
1 answer

fuzzy k-mode clustering membership value calculation

I was searching for a clustering algorithm to fuzzy cluster categorical attributes and I found the k-modes algorithm I've got the way it works but I'm not understanding if the membership or belonging matrix is calculated the same way as this matrix…
Mariya
  • 847
  • 1
  • 9
  • 25
1
vote
0 answers

weight inputs in Fuzzy Logic System

I am using the fuzzy logic designer app on matlab 2022a to create an output score from 0 to 100 from input variables also ranging from 0 to 100. I saw that it is possible to weight the rules but does anyone know if it is possible to associate a…
alice
  • 57
  • 6
1
vote
1 answer

How to match two dataframes by applying fuzzy_pandas merge on different columns?

I have an input and a master file in which I first tried doing an exact match using the fpd.fuzzy_merge function, which seems to be working perfectly. Afterwards, I want to start applying the levenshtein method with different thresholds on the…
Linear17
  • 148
  • 9
1
vote
1 answer

substring merge two dataframes of different sizes based on a column

I have 2 dataframes like these: df1 Alias seq_RNA Hsa-Mir-133-P2-v1-5p AGCTGGTAAAATGGAACCAAATC Hsa-Mir-143-P1-v2-3p TTGGTCCCCTTCAACCAGCTGT Hsa-Mir-183-P1-v1-3p TTTGGTCCCCTTCAACCAGCTGT Hsa-Mir-490-3p CAACCTGGAGGACTCCATGCTGT Hsa-Mir-499-5p…
pino
  • 83
  • 7
1
vote
2 answers

SQL - Fuzzy JOIN on Timestamp columns within X amount of time

Say I have two tables: a: timestamp precipitation 2015-08-03 21:00:00 UTC 3 2015-08-03 22:00:00 UTC 3 2015-08-04 3:00:00 UTC 4 2016-02-04 18:00:00 UTC 4 and b: timestamp loc 2015-08-03 21:23:00 UTC San…
Justin Young
  • 41
  • 5
1
vote
0 answers

Bayesian belief network/system with Fuzzy Clustering neural networks

Many researches have argued that Artificial Neural Networks (ANNs) can improve the performance of intrusion detection systems (IDS) when compared with traditional methods. However for ANN-based IDS, detection precision, especially for…
G Gr
  • 6,030
  • 20
  • 91
  • 184
1
vote
1 answer

Efficiently find the shortest unique string ending in array of strings

I have an array of pseudo-random strings like this: let values = [ '4730788382dd8d15bD1Dfb', '078846cf883d8d15bD1DZb', '4730g21e260857Fb5771d3', 'fecc51b693F9A0Cec49fd2', 'c14a621e263857Fb577fd3', '7936CcfF6cD3bd71DBF121', …
Olivier Leprohon
  • 63
  • 6
1
vote
1 answer

How to use the percentage of matches to decide if two characters match in R

Context I have two vectors. fruits_Jack_eat is a vector of length=1 that stores the fruits Jack ate. fruits_list is a vector of length=3 that stores different types of fruits. Question I want to find out if Jack ate 1 or more fruits in the…
zhiwei li
  • 1,635
  • 8
  • 26
1
vote
1 answer

Matching Numbers that are Close in Value in Alteryx

I have two different datasets with different values in Alteryx. The one dataset serves as a lookup table for the other. For example: Name   Code Source ================== Al      124.5 A Bill    324.1 A Cody    947.6 A Dan    543.2 …
324
  • 702
  • 8
  • 28
1
vote
0 answers

Can we solve fuzzy linear programming using GLPK python?

I am exploring fuzzy linear programming for my current project. I am already using GLPK API using python for solving linear programming problems. I want to know if I can solve fuzzy LPP using GLPK
Monish Kumar
  • 11
  • 2
1
vote
1 answer

Fuzzy matching column with right names of a list

I have dataframe column with typos. ID Banknane 1 Bank of America 2 bnk of America 3 Jp Morg 4 Jp Morgan And I have a list with the right names of the banks. ["Bank of America", "JPMorgan Chase] I want to check and replace wrong…
Gevorg Atanesyan
  • 49
  • 5
1
vote
2 answers

Perform Fuzzy Matching in 2 pandas dataframe

I have two dataframes with different rows numbers contain information about players. The first has all names that I need. df1 = pd.DataFrame({'Player': ["John Sepi", 'Zan Fred', 'Mark Daniel', 'Adam Pop', 'Paul Sepi', 'John Hernandez', 'Price…
Neto
  • 15
  • 4
1
vote
0 answers

Why am getting precision , recall as zero in ANFIS model using tensorflow in python

i have build ANFIS model with tensorflow for classification problem. For every epoch i am getting precision and recall as zero. I am using guassian membership function but when i print sigma it is giving 0.Used below code for training ## settings n…
crazycoders
  • 35
  • 4
1 2 3
…
24 25