Stack Overflow
Stack Overflow

Questions tagged [biopython]

Biopython is a set of freely available tools for biological computation written in Python. Please only use this tag for issues relating to the Biopython suite of tools.

Biopython is a set of freely available tools for biological computation written in Python. It is developed by The Biopython Project, an international association of developers of Python tools for computational molecular biology. It includes a range of bioinformatics functionalities such as:

  • Parsing bioinformatics files into data structures usable by Python

  • Interfaces to commonly used bioinformatics programs (BLAST, Clustalw, EMBOSS among others)

  • Class for dealing with DNA, RNA and protein sequences. This includes feature annotations.

  • Tools for performing common operations on sequences, such as translation, transcription and weight calculations

amongst many, many others.

The biopython tag

Questions with tag should relate to issues involving the Biopython package of tools.

Learning More

The web site http://www.biopython.org provides an online resource for modules, scripts, and web links for developers of Python-based software for life science research. It also has a useful wiki site.

The Biopython Cookbook provides many examples of Biopython being used as well as installation instructions and a FAQ section.

1345 questions
-2
votes
3 answers

how to make biopython read sequences from a fasta file and assign them as input to RNAfold for structure prediction?

I need a program to read each sequence from a fasta file (about 1000sequences) and use each as input to another application (RNAfold) for secondary structure prediciton. I am using python. is it possible? could someone give me a guideline code for a…
Armand
  • 19
  • 1
  • 5
-3
votes
1 answer

Rosalind doesn't accept "Variables and Some Arithmetic" task

Link for the problem http://rosalind.info/problems/ini2/ Given: Two positive integers a and b, each less than 1000. Return: The integer corresponding to the square of the hypotenuse of the right triangle whose legs have lengths a and b For…
Starim
  • 3
  • 2
-3
votes
2 answers

Biopython - String assigning error

I tried to begin with Biopython. So that I can do my thesis in it. But this really makes me think twice. Show features missing, when I tried a integer value, it does not work and same is the case with string too. Kindly help. Thank…
user3668772
  • 19
  • 5
-4
votes
1 answer

Pairwise seqence alignment in Biopython

How to do pairwise sequence alignment in Biopython? Can I get sample code for this?
saraswathi
  • 93
  • 1
  • 3
  • 7
-4
votes
1 answer

how to write in python without using Biopython package

​I am willing to write a program to extract amino acid sequence corresponding to the features of type "Region" as separate Fasta file and to list out the amino acids and positions with "Site" of site_type="phosphorylation". WITHOUT USING Biopython…
Siva Shanmugam
  • 662
  • 9
  • 19
-4
votes
1 answer

Muscle alignment in python

I have a problem with printing my output from muscle aligning in python. My code is: from Bio.Align.Applications import MuscleCommandline from StringIO import StringIO from Bio import AlignIO def align_v1 (Fasta): muscle_cline =…
Peter parker
  • 1
  • 1
  • 1
-5
votes
1 answer

I want to sort data from pdb file in perl or python

I want to print sequence of Ribose Puckering. Script in perl: open (filehandler, "List_NAD_ID.txt") or die $!; #Input file my @file1=; my $OutputDir = 'C:\Users\result'; #output directory path foreach my $line (@file1) …
krish
  • 69
  • 1
  • 4
  • 9
-5
votes
1 answer

parsing blastp output using biopython

I need help to parse the following blastp output for aligning 2 sequences: BLASTP 2.2.28+ Query= Length=237 Subject= Length=268 Score = 429 bits (1104), Expect = 2e-157, Method: Compositional matrix adjust. Identities = 237/268 (88%),…
user313058
  • 1
  • 2
-5
votes
1 answer

how to find maximum k-mer in a sequence

Sample Input: ACGTTGCATGTCGCATGATGCATGAGAGCT # this is the sequence in which we have to search 4 # this is the k-mer(integer value) Sample Output: CATG GCAT I do not understand how to do this. Please help me. Thanks in advance.
Ashish Pathak
  • 27
  • 4
1 2 3
…
89
90